AAV Packaging Mix (Serotype 1)

AAV Packaging Mix (Serotype 1)

Cat. No.	AAV1001
Unit	100 µg

Cat. No.	AAV1001
Name	AAV Packaging Mix (Serotype 1)
Unit	100 µg
Description	For the production of helper-free Adeno-associated virus (AAV) particles, three components are generally required: 1) an AAV expression vector containing your insert of interest (cDNA, shRNA, or miRNA), 2) a packaging vector which contains all necessary adenoviral genes eliminating the need for a helper adenovirus, and 3) a packaging vector expressing the replication (Rep) and capsid (Cap) proteins responsible for determining the serotype and tropism of the AAV. All of abm’s AAV expression vectors contain wildtype ITR sequences and can be packaged using any of the serotype-specific packaging mixes listed, which are conveniently pre-mixed for each serotype so only the expression vector and the single packaging mix are required for transfection. The packaging mix provided in each kit is sufficient for packaging three viruses at 109 GC/ml titer, and is also available in a combo pack with the DNAfectin transfection reagent (1ml, Cat. G2100) for added cost savings and convenience.
Note	NOT FOR RESALE without prior written consent of ABM. This product is distributed for laboratory research only.

Datasheet

AAV1001 Datasheet

Search CoA here

Supporting Protocol

What is the difference between Retro-, Lenti-, and Adeno- viruses?

Retrovirus: Classic, can integrate into the genome but with low transduction efficiency. They are useful for gene transfer and protein expression in cells that have low transfection efficiency with other transfection reagents. Lentivirus: Can integrate into the genome with relatively high transduction efficiency and they are very useful for cells that have low transfection efficiency with other transfection reagents. No special competent cells required, as they are stable plasmids. Lentiviruses are a powerful tool for stable gene transfer to both dividing and non-dividing cells in vitro and in vivo. Adenovirus: Only work transiently (about 7 days) but have almost 100% transduction efficiency. Adenoviruses can infect a broad range of cell types with the highest efficiency and infection is not dependent on active host cell division. A second key feature is that high virus titers and high-level gene expression can be obtained in most mammalian cells.

What are the correct concentration units for each recombinant viral particle?

For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.

What do I use to check if my cells were successfully immortalized by the SV40 agent?

We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202. Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below: http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html

What are the primers to use for SV40 identification?

SV40 Forward Primer Sequence 5’ ACTGAGGGGCCTGAAATGA SV40 Reverse Primer Sequence 5’ GACTCAGGGCATGAAACAGG These are qPCR primers and the band size is 61 bp.

What advantages / disadvantages exist between the Lenti-SV40, -SV40T, and SV40T+t vectors?

There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only. It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.