2nd Generation Packaging System Mix

2nd Generation Packaging System Mix

Cat. No.	LV003
Unit	200µl

Cat. No.	LV003
Name	2nd Generation Packaging System Mix
Unit	200µl
Description	For the production of lentiviral particles, three components are generally required: 1) a lentiviral vector containing your inserts of interest, 2) one or two packaging vectors which contain all necessary viral structure proteins, 3) an envelope vector expressing Vesicular Stomatitis Virus (VSV) glycoprotein (G). In general, lentiviral vectors with a wildtype 5' LTR need the 2nd generation packaging system because these vectors require TAT for activation. However, the 2nd generation packaging mix will also support the production of 3rd lentiviral expression vector with a chimeric 5' LTR. All the lentiviral expression vectors marketed by ABM are 3rd generation with a chimeric of RSV promoter upstream of 5'-LTR. Packaging Mix Components (200ul mix of 2 plasmids) : pLenti-P2A, pLenti-P2B Selection: Ampicillin (Bacterial Selection) Amount: 200 μl (100 µg mixture of pLenti-P2A and pLenti-P2B) Appearance: Liquid Storage Temperature: -20°C or below (shipped at ambient temperature) Shelf Life: Up to 1 year (when at -20°C or below in a frost-free freezer) User Manual: Refer to website for downloadable Lentivirus Packaging Protocol
Note	NOT FOR RESALE without prior written consent of ABM. This product is distributed for laboratory research only.

Datasheet

LV003 Datasheet

Search CoA here

Supporting Protocol

Other

What is the difference between Retro-, Lenti-, and Adeno- viruses?

Retrovirus: Classic, can integrate into the genome but with low transduction efficiency. They are useful for gene transfer and protein expression in cells that have low transfection efficiency with other transfection reagents. Lentivirus: Can integrate into the genome with relatively high transduction efficiency and they are very useful for cells that have low transfection efficiency with other transfection reagents. No special competent cells required, as they are stable plasmids. Lentiviruses are a powerful tool for stable gene transfer to both dividing and non-dividing cells in vitro and in vivo. Adenovirus: Only work transiently (about 7 days) but have almost 100% transduction efficiency. Adenoviruses can infect a broad range of cell types with the highest efficiency and infection is not dependent on active host cell division. A second key feature is that high virus titers and high-level gene expression can be obtained in most mammalian cells.

What are the correct concentration units for each recombinant viral particle?

For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.

What do I use to check if my cells were successfully immortalized by the SV40 agent?

We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202. Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below: http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html

What are the primers to use for SV40 identification?

SV40 Forward Primer Sequence 5’ ACTGAGGGGCCTGAAATGA SV40 Reverse Primer Sequence 5’ GACTCAGGGCATGAAACAGG These are qPCR primers and the band size is 61 bp.

How do I convert a generation 3 lentiviral vector into a vector that can be used by generation 2 packaging system?

All second generation packaging systems can package both second and third generation lentiviral expression vectors.

Is it possible to make our own plasmid preparations from the packaging mix and then use them in transfections?

Unfortunately it is not possible to amplify these plasmids as they are provided in a pre-made mixture.

What advantages / disadvantages exist between the Lenti-SV40, -SV40T, and SV40T+t vectors?

There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only. It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.

Jin, Q et al. "Decreased Tumor Progression and Invasion by a Novel Anti-Cell Motility Target for Human Colorectal Carcinoma Cells" PLoS ONE 8(6):e66439 (2013). DOI: doi:10.1371/journal.pone.0066439.
Pae, EK;Kim, G;, et al. "Insulin production hampered by intermittent hypoxia via impaired zinc homeostasis" PLoS ONE 9-2:e90192 (2014). PubMed: 24587273.
Jin, Q;Liu, G;Domeier, PP;Ding, W;Mulder, KM;, et al. "Decreased tumor progression and invasion by a novel anti-cell motility target for human colorectal carcinoma cells" PLoS ONE 8-6:e66439 (2013). PubMed: 23755307.
Taylor, HE et al. "The Innate Immune Factor Apolipoprotein L1 Restricts HIV-1 Infection" J. Virol. 1:592-603 (2014). DOI: 10.1128/JVI.02828-13. PubMed: 24173214. Application: Viral Packaging.
Morgan, S. "PKA as the Effector of Beta-2-Adrenoreceptor Signaling Regulating Airway Smooth Muscle Relaxation" Thesis : (2013). Application: Viral Packaging.
Li, FY et al. "Second messenger role for Mg2+ revealed by human T-cell immunodeficiency" Nature 475:471 - 6 (2011). DOI: 10.1038/nature10246. PubMed: 21796205. Application: Transfection.
George, R et al. "A SHORT INTERFERING RNA MOLECULAR BEACON FOR THE ATTENUATION OF MYCOBACTERIAL INFECTION" American Journal of Biochemistry and Biotechnology 10:40-49 (2014). DOI: 10.3844/ajbbsp.2014.40.49. Application: Viral Packaging.
Pae, E. K. et al. "Insulin Production Hampered by Intermittent Hypoxia Via Impared Zinc Homeostasis " PLoS One 2:e90192 (2014). DOI: 10.1371/journal.pone.0090192. PubMed: 24587273. Application: Lentivirus Production .
Zhang, J et al. "The construction and proliferative effects of a lentiviral vector capable of stably overexpressing SPINK1 gene in human pancreatic cancer AsPC-1 cell line" Tumour Biol. :1-9 (2015). PubMed: 26586397.
Morgan, SJ et al. "β-Agonist-mediated relaxation of airway smooth muscle is protein kinase A-dependent" J Biol Chem 289(33):23065-74 (2014). DOI: 10.1074/jbc.M114.557652. PubMed: 24973219.
Juang, YL et al. "PRRX2 as a novel TGF-β-induced factor enhances invasion and migration in mammary epithelial cell and correlates with poor prognosis in breast cancer" Mol Carcinog : (2016). DOI: 10.1002/mc.22465. PubMed: 26824226.
Nangami, et al. "Fetuin-A (alpha 2HS glycoprotein) modulates growth, motility, invasion, and senescence in high-grade astrocytomas" Cancer Medicine : (2016). DOI: 10.1002/cam4.940. Application: Knockdown of Cell Line.
Juang, YL et al. "PRRX2 as a novel TGF-β-induced factor enhances invasion and migration in mammary epithelial cell and correlates with poor prognosis in breast cancer" Molecular Carcinogenesis 55.12:2247–2259 (2016). DOI: 10.1002/mc.22465. Application: Packaging.
Zhang, et al. "The construction and proliferative effects of a lentiviral vector capable of stably overexpressing SPINK1 gene in human pancreatic cancer AsPC-1 cell line" Tumour Biology 37.5:5847 (2016). DOI: 10.1007/s13277-015-4405-z. Application: Generation of lentiviral vectors.
Geekiyanage, H et al. "MiR-31 and miR-128 regulates poliovirus receptor-related 4" Mol Oncol 9:1387-1403 (2016). DOI: 10.1016/j.molonc.2016.07.007.
Gomaa, A., Peng, D., Chen, Z., Soutto, M., Abouelezz, K., Corvalan, A., & El-Rifai, W. "Epigenetic regulation of AURKA by miR-4715-3p in upper gastrointestinal cancers" Scientific reports 9(1):1-11 (2019).