No, because retroviruses are too sensitive to survive the required centrifugation step.

No, the function will not be affected.

The pelleted lentivirus can be resuspended in any appropriate buffer.

Yes it is possible but the lentivirus should go through a buffer exchange procedure. Our recommended method is loading the resuspended lentivirus onto a 20mL-50uL ultrafiltration unit (30,000 MWCO), add PBS, then wash out the matrix by multiple centrifuge spins and discard the flowthrough. Once the exchange has occurred, use the desired volume of solvent to resuspend the lentivirus from the top filter and aliquot into storage containers.

Retrovirus: Classic, can integrate into the genome but with low transduction efficiency. They are useful for gene transfer and protein expression in cells that have low transfection efficiency with other transfection reagents. Lentivirus: Can integrate into the genome with relatively high transduction efficiency and they are very useful for cells that have low transfection efficiency with other transfection reagents. No special competent cells required, as they are stable plasmids. Lentiviruses are a powerful tool for stable gene transfer to both dividing and non-dividing cells in vitro and in vivo. Adenovirus: Only work transiently (about 7 days) but have almost 100% transduction efficiency. Adenoviruses can infect a broad range of cell types with the highest efficiency and infection is not dependent on active host cell division. A second key feature is that high virus titers and high-level gene expression can be obtained in most mammalian cells.

For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.

We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202. Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below: http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html

We recommend a low protein binding filter with membrane pores of 0.2-0.45um. A few suggested membrane materials are PVDF, PES, and Supor (from Pall).

SV40 Forward Primer Sequence 5’ ACTGAGGGGCCTGAAATGA SV40 Reverse Primer Sequence 5’ GACTCAGGGCATGAAACAGG These are qPCR primers and the band size is 61 bp.

There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only. It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.

The SV40 covers the entire genome and the accession number is J02400.1. You can use this information to design primers for conventional PCR as well.

You can observe transduction efficiency from 48 hours up to 5 days after infection.

PCR primers: SV40T Forward Primer Sequence 5’ AGCCTGTAGAACCAAACATT 3' SV40T Reverse Primer Sequence 5’ CTGCTGACTCTCAACATTCT 3' The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.

This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.

When using our Speedy Lentivirus Purification (Cat#LV999), the choice of which medium and FBS to use to keep the concentrated viruses will vary based upon the intended downstream application of the lentivirus; i.e. depending on the complete media required for your cell line of interest. You can re-suspend the pellet in the complete media of the cell line which will be infected with this virus prep, to avoid dilution. For example, if 293T cells were the intended cell line, we would recommend using DMEM + 10% FBS. If in doubt, serum-free DMEM is typically a safe choice, however the required dilution will be a factor to consider.

The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).

The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.