페이지 선택

AAV Packaging Mix (Serotype 4)

Cat. No.
E086
Unit
20 Reactions
Cat. No. AAV1004
Name AAV Packaging Mix (Serotype 4)
Unit 100 µg
Description For the production of helper-free Adeno-associated virus (AAV) particles, three components are generally required: 1) an AAV expression vector containing your insert of interest (cDNA, shRNA, or miRNA), 2) a packaging vector which contains all necessary adenoviral genes eliminating the need for a helper adenovirus, and 3) a packaging vector expressing the replication (Rep) and capsid (Cap) proteins responsible for determining the serotype and tropism of the AAV. All of abm’s AAV expression vectors contain wildtype ITR sequences and can be packaged using any of the serotype-specific packaging mixes listed, which are conveniently pre-mixed for each serotype so only the expression vector and the single packaging mix are required for transfection. The packaging mix provided in each kit is sufficient for packaging three viruses at 109 GC/ml titer, and is also available in a combo pack with the DNAfectin transfection reagent (1ml, Cat. G2100) for added cost savings and convenience.
Note NOT FOR RESALE without prior written consent of ABM. This product is distributed for laboratory research only.
Search CoA here

For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.

We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202. Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below: http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html

SV40 Forward Primer Sequence 5’ ACTGAGGGGCCTGAAATGA SV40 Reverse Primer Sequence 5’ GACTCAGGGCATGAAACAGG These are qPCR primers and the band size is 61 bp.

There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only. It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.

The SV40 covers the entire genome and the accession number is J02400.1. You can use this information to design primers for conventional PCR as well.

You can observe transduction efficiency from 48 hours up to 5 days after infection.

PCR primers: SV40T Forward Primer Sequence 5’ AGCCTGTAGAACCAAACATT 3' SV40T Reverse Primer Sequence 5’ CTGCTGACTCTCAACATTCT 3' The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.

This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.

The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).

The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.

There are no references for this product yet!

This product has no review yet.

Controls and Related Product: 

DNAfectin™ Plus Transfection Reagent


Cat. No.
G2500
Unit
1.0 ml

2nd Generation Packaging System Mix


Cat. No.
LV003
Unit
200µl

qPCR Lentivirus Titer Kit


Cat. No.
LV900
Unit
100 rxn

3rd Generation Packaging System Mix


Cat. No.
LV053
Unit
200µl

ViralEntry™ Transduction Enhancer (100X)


Cat. No.
G515
Unit
1.0 ml

Lentivirus Promoter Blast™ kit


Cat. No.
LV950
Unit
4 x 1ml