3rd Generation Packaging System Mix

3rd Generation Packaging System Mix

Cat. No.	LV053
Unit	200µl

Cat. No.	LV053
Name	3rd Generation Packaging System Mix
Unit	200µl
Description	For the production of lentiviral particles, three components are generally required: 1) a lentiviral vector containing your inserts of interest, 2) one or two packaging vectors which contain all necessary viral structure proteins, 3) an envelope vector expressing Vesicular Stomatitis Virus (VSV) glycoprotein (G). The 3rd generation packaging system offers maximal biosafety as the lentiviral Rev gene is supplied as an independent vector from other structure genes, further eliminating the possibility of reverse recombination of vectors into replication competent viral particles. The 3rd generation lentiviral packaging mix will only support lentiviral expression vectors with a chimeric 5' LTR in which the HIV promoter is replaced with CMV or RSV, thus making it TAT-independent. The 3rd generation lentiviral vectors will not support the production of 2nd generation lentiviral particle productions. All of the lentiviral vectors marketed by ABM are TAT-independent. Selection: Ampicillin (Bacterial Selection) Amount: 200 μl (100 µg mixture of pLenti-P3A, pLenti-P3B, and pLenti-P3C) Appearance: Liquid Storage: Temperature °20-C or below (shipped at ambient temperature) Shelf Life: Up to 1 year (when at °20-C or below in a frost-free freezer) User Manual Refer to website for downloadable user manual*
Note	NOT FOR RESALE without prior written consent of ABM. This product is distributed for laboratory research only.

Print & Download Datasheet

Search CoA here

Supporting Protocol

Other

What is the difference between Retro-, Lenti-, and Adeno- viruses?

Retrovirus: Classic, can integrate into the genome but with low transduction efficiency. They are useful for gene transfer and protein expression in cells that have low transfection efficiency with other transfection reagents. Lentivirus: Can integrate into the genome with relatively high transduction efficiency and they are very useful for cells that have low transfection efficiency with other transfection reagents. No special competent cells required, as they are stable plasmids. Lentiviruses are a powerful tool for stable gene transfer to both dividing and non-dividing cells in vitro and in vivo. Adenovirus: Only work transiently (about 7 days) but have almost 100% transduction efficiency. Adenoviruses can infect a broad range of cell types with the highest efficiency and infection is not dependent on active host cell division. A second key feature is that high virus titers and high-level gene expression can be obtained in most mammalian cells.

What are the correct concentration units for each recombinant viral particle?

For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.

What do I use to check if my cells were successfully immortalized by the SV40 agent?

We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202. Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below: http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html

What are the primers to use for SV40 identification?

SV40 Forward Primer Sequence 5’ ACTGAGGGGCCTGAAATGA SV40 Reverse Primer Sequence 5’ GACTCAGGGCATGAAACAGG These are qPCR primers and the band size is 61 bp.

How do I convert a generation 3 lentiviral vector into a vector that can be used by generation 2 packaging system?

All second generation packaging systems can package both second and third generation lentiviral expression vectors.

Is it possible to make our own plasmid preparations from the packaging mix and then use them in transfections?

Unfortunately it is not possible to amplify these plasmids as they are provided in a pre-made mixture.

What advantages / disadvantages exist between the Lenti-SV40, -SV40T, and SV40T+t vectors?

There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only. It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.

Chan, MM et al. "Proteome profile and lentiviral transduction of cultured honey bee (Apis mellifera L.) cells" Insect Mol Biol 19(5):653-8 (2010). DOI: 10.1111/j.1365-2583.2010.01022.x. PubMed: 20546039.
Ordelheide, AM et al. "Nor-1, a novel incretin-responsive regulator of insulin genes and insulin secretion" Mol Metab 2(3):243-55 (2013). DOI: 10.1016/j.molmet.2013.06.003. PubMed: 24044104.
Kim, D et al. "Peroxisomal dysfunction is associated with up-regulation of apoptotic cell death via miR-223 induction in knee osteoarthritis patients with type 2 diabetes mellitus" Bone 64C:124-131 (2014). DOI: 10.1016/j.bone.2014.04.001. PubMed: 24727161.
Kim, D et al. " Two non-coding RNAs, MicroRNA-101 and HOTTIP contribute cartilage integrity by epigenetic and homeotic regulation of integrin-α1" Cell. Signal. 25:2878 - 87 (2013). DOI: 10.1016/j.cellsig.2013.08.034. PubMed: 24018042. Application: Viral Packaging.
George, R et al. "A SHORT INTERFERING RNA MOLECULAR BEACON FOR THE ATTENUATION OF MYCOBACTERIAL INFECTION" American Journal of Biochemistry and Biotechnology 10:40-49 (2014). DOI: 10.3844/ajbbsp.2014.40.49. Application: Viral Packaging.
Song, J et al. "A long non-coding RNA, GAS5, plays a critical role in the regulation of miR-21 during osteoarthritis" Journal of Orthopaedic Research 32(12):1628-1635 (2014). DOI: 10.1002/jor.22718. PubMed: 25196583.
Song, J et al. "MicroRNA-222 regulates MMP-13 via targeting HDAC-4 during osteoarthritis pathogenesis" BBA Clin : (2014). DOI: 10.1016/j.bbacli.2014.11.009. PubMed: 26673737.
Morgan, S et al. "β-Agonist-mediated relaxation of airway smooth muscle is protein kinase A-dependent" J Biol Chem 289(33):23065-23075 (2014). DOI: 10.1074/jbc.M114.557652. PubMed: 24973219.
Kim, D et al. "Peroxisomal dysfunction is associated with up-regulation of apoptotic cell death via miR-223 induction in knee osteoarthritis patients with type 2 diabetes mellitus" Bone 64:124-131 (2014). DOI: 10.1016/j.bone.2014.04.001. PubMed: 24727161. Application: Viral Packaging.
Song, J et al. "miR-370 and miR-373 regulate the pathogenesis of osteoarthritis by modulating one-carbon metabolism via SHMT-2 and MECP-2, respectively" Aging Cell 5:826-837 (2015). DOI: 10.1111/acel.12363. PubMed: 26103880.
Song, J et al. "A long non-coding RNA, GAS5, plays a critical role in the regulation of miR-21 during osteoarthritis" J Orthop Res 32(12):1628-1635 (2014). DOI: 10.1002/jor.22718. PubMed: 25196583. Application: Gene Delivery, Lentivirus.
Song, J et al. "MicroRNA-222 regulates MMP-13 via targeting HDAC-4 during osteoarthritis pathogenesis" BBA Clin. :79-89 (2015). DOI: 10.1016/j.bbacli.2014.11.009.
Song, J et al. "PBMC and exosome-derived Hotair is a critical regulator and potent marker for rheumatoid arthritis" Clin Exp Med. 1:121-126 (2015). DOI: 10.1007/s10238-013-0271-4. PubMed: 24722995.
Kang, Y et al. "PCGEM1 stimulates proliferation of osteoarthritic synoviocytes by acting as a sponge for miR-770" J Orthop Res. : (2015). DOI: 10.1002/jor.23046.
Rong, H et al. ""Notch signaling suppresses regulatory T cell function in murine experimental autoimmune uveitis "" Immunology 149.4:447-459 (2016). DOI: 10.1111/imm.12663.
Wang, J et al. "Radiofrequency hyperthermia-enhanced herpes simplex virus-thymidine kinase/ganciclovir direct intratumoral gene therapy of hepatocellular carcinoma" American Journal of Cancer Research 6.9:2054–2063 (2016). DOI: 10.1080/02656736.2016.1229045. Application: Animal infection.
Kang, et al. "PCGEM1 stimulates proliferation of osteoarthritic synoviocytes by acting as a sponge for miR-770" Journal of Orthopaedic Research 34.3:412 (2016). DOI: 10.1002/jor.23046. Application: Lentiviral infection.
Jin, G., Li, Y., Zhang, F., Li, P., Zhao, L., Zhou, Y., ... & Yang, X. "Epithelial ovarian cancer: feasibility of image-guided intratumoral radiofrequency hyperthermia-enhanced direct gene therapy" American journal of cancer research 9(2):378 (2019).
Omura, H., Liu, F., Shimakami, T., Murai, K., Shirasaki, T., Kitabayashi, J., Funaki, M., Nishikawa, T., Nakai, R., Sumiyadorj, A., Hayashi, T., Yamashita, T., Honda, M., Kaneko, S. "Establishment and Characterization of a New Cell Line Permissive for Hepatitis C Virus Infection" Scientific Reports 9:7943 (2019). DOI: 10.1038/s41598-019-44257-5.