Lentivirus Packaging Kit

Lentivirus Packaging Kit

Cat. No.	LV098
Unit	1 Kit

Cat. No.

LV098

Name

Lentivirus Packaging Kit

Unit

1 Kit

Description

Recombinant lentiviral vectors have been shown to be a powerful tool for stable gene transfer to both dividing and non-dividing cells in vitro and in vivo. Through years of experience with lentiviral vectors, scientists at ABM have developed our own proprietary Lentiviral expression vectors and Lenti-combo packaging mix that allow for rapid production of recombinant lentiviral vectors with titers up to 107IU/mL. Lenti-Easy-His vector allows transgene expression with His tag for easy detection of expressed recombinant protein.

Additional Information

Kit components:

Product	Quantity	Kit Catalog Number				Individual Cat. No.
Product	Quantity	LV200	LV210	LV098	LV099	Individual Cat. No.
Lenti-Easy-HA Tag Vector	10ug	✔️	✔️			LV005
Lenti-Packaging Mix	100ug	✔️	✔️	✔️		LV003
DNAfectin Plus	1.0ml	✔️		✔️		G2500
293T Cells	1x10⁶	✔️			✔️	LV010
Lenti-GFP	10ug	✔️			✔️	LV011-a

Note

NOT FOR RESALE without prior written consent of ABM. This product is distributed for laboratory research only. * pricing for blank cloning vectors for commercial customers is 1.5x the listed price

Print & Download Datasheet

Search CoA here

Supporting Protocol

What is the difference between Retro-, Lenti-, and Adeno- viruses?

Retrovirus: Classic, can integrate into the genome but with low transduction efficiency. They are useful for gene transfer and protein expression in cells that have low transfection efficiency with other transfection reagents. Lentivirus: Can integrate into the genome with relatively high transduction efficiency and they are very useful for cells that have low transfection efficiency with other transfection reagents. No special competent cells required, as they are stable plasmids. Lentiviruses are a powerful tool for stable gene transfer to both dividing and non-dividing cells in vitro and in vivo. Adenovirus: Only work transiently (about 7 days) but have almost 100% transduction efficiency. Adenoviruses can infect a broad range of cell types with the highest efficiency and infection is not dependent on active host cell division. A second key feature is that high virus titers and high-level gene expression can be obtained in most mammalian cells.

What are the correct concentration units for each recombinant viral particle?

For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.

What do I use to check if my cells were successfully immortalized by the SV40 agent?

We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202. Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below: http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html

What are the primers to use for SV40 identification?

SV40 Forward Primer Sequence 5’ ACTGAGGGGCCTGAAATGA SV40 Reverse Primer Sequence 5’ GACTCAGGGCATGAAACAGG These are qPCR primers and the band size is 61 bp.

What advantages / disadvantages exist between the Lenti-SV40, -SV40T, and SV40T+t vectors?

There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only. It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.